mannose-binding lectin (protein C) 2, soluble (MBL2) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the MBL2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000010.10, covering MBL2 transcript NM_000242.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.9
 ACTTTTTGA                                                          c.9
 T  F  X                                                            p.2

          .         .         .         .         .         .       g.69
 tacgtgccatttctgtttgcagagcttttctttctgaggcagccaggctactatcaccat       c.*60

  | 02       .         .         .         .         .         .    g.1483
  | ccggactttttccagggtctcctttttggccctttggtcctggtgacccagaaggccctg    c.*120

          .         .         .         .         .        | 03.    g.2205
 gatttcctggaggccccaactttccaggggggccctgtaagcctctgagcccttggc | ctg    c.*180

          .         .         .         .         .         .       g.2265
 gttcccccttttctcccttggtgccatcacgcccatctttgcctgggaagccgttgatgc       c.*240

          .         .         .         .         .         .       g.2325
 ctggagagctacaggcaatcactgcagggcaggtcttttgggcatcctcacaggtcacag       c.*300

          .         .         .         .         .         .       g.2385
 tttctgagtaagacgctgccaccatactcaggagaaggagagggagtgatggaaacaggg       c.*360

          .         .         .         .         .         .       g.2445
 acatggtcctcaccttggtgtgagaaaactcagggaaggttaatctcagttaatgaacac       c.*420

           | 04        .         .         .         .         .                                                      g.2505
 atatttacc | t                                                      c.*430

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Mannose-binding lectin (protein C) 2, soluble protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.