ras homolog family member H (RHOH) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the RHOH gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000004.11, covering RHOH transcript NM_004310.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.6900
                                                         tatt       c.-721

 .         .         .         .         .         .                g.6960
 ctaatggagagaaacgcacgtgcacacacacccccctaaacccacacaaatgaaaccccc       c.-661

 .         .         .         .         .         .                g.7020
 tctgcggagaagccggctacaggaaattgacttaggcacaggaacttgctaatctctttt       c.-601

 .         .         .         .         .         .                g.7080
 gtcacattcggattgctcctgctgccccacacacactaacccaaccatcttggggtggac       c.-541

 .         .         .         .         .         .                g.7140
 tccctgccagcccaactgttgtattttcagttcttccagtgtgaatcagttaatattctc       c.-481

 .         .         .         .         .         .                g.7200
 gggaacgagggagaggttgatcctatgaggaaatcaaccacagtgaaaaggcttgggccg       c.-421

 .         .         .         .         .         .                g.7260
 cttttgttttcacctgcttttgttgaacaaatttgatttccggagtcagtcattttactg       c.-361

 .         .         .          | 02        .         .             g.52733
 tcaagacatttcttcggcattctgcaacag | tttccaacatggctagatccatcagaaact    c.-301

 .         .         .         .         .         .                g.52793
 gaagccgtggagaacgctctcggggcctttgccacttcttggagtagaagccgacagaga       c.-241

 .         .         .         . | 03       .         .             g.53196
 gctgtttggaaacttctccttcacacaccag | ttgaagactaggctttggaggttttcaaa    c.-181

 .         .         .         .         .         .                g.53256
 gcagacggtgcttggatgggcagggagaagtaacattctgcaaatcgccgtcagaggtcc       c.-121

 .         .         .         .         .         .                g.53316
 tgaggacacagacctacctggcttgcattccccttgctgaatggcgtgtgctgcagctgc       c.-61

 .         .         .         .         .         .                g.53376
 ccactgagggctcttttccctgggattctggacttcagagtaggacagcaggctgggaag       c.-1

          .         .         .         .         .         .       g.53436
 ATGCTGAGTTCCATCAAGTGCGTGTTGGTGGGCGACTCTGCTGTGGGGAAAACCTCTCTG       c.60
 M  L  S  S  I  K  C  V  L  V  G  D  S  A  V  G  K  T  S  L         p.20

          .         .         .         .         .         .       g.53496
 TTGGTGCGCTTCACCTCCGAGACCTTCCCGGAGGCCTACAAGCCCACAGTGTACGAGAAC       c.120
 L  V  R  F  T  S  E  T  F  P  E  A  Y  K  P  T  V  Y  E  N         p.40

          .         .         .         .         .         .       g.53556
 ACAGGGGTGGACGTCTTCATGGATGGCATCCAGATCAGCCTGGGCCTCTGGGACACAGCC       c.180
 T  G  V  D  V  F  M  D  G  I  Q  I  S  L  G  L  W  D  T  A         p.60

          .         .         .         .         .         .       g.53616
 GGCAATGACGCCTTCAGAAGCATCCGGCCCCTGTCCTACCAGCAGGCAGACGTGGTGCTG       c.240
 G  N  D  A  F  R  S  I  R  P  L  S  Y  Q  Q  A  D  V  V  L         p.80

          .         .         .         .         .         .       g.53676
 ATGTGCTACTCTGTGGCCAACCATAACTCATTCCTGAACTTGAAGAACAAGTGGATTGGT       c.300
 M  C  Y  S  V  A  N  H  N  S  F  L  N  L  K  N  K  W  I  G         p.100

          .         .         .         .         .         .       g.53736
 GAAATTAGGAGCAACTTGCCCTGTACCCCTGTGCTGGTGGTGGCCACCCAGACTGACCAG       c.360
 E  I  R  S  N  L  P  C  T  P  V  L  V  V  A  T  Q  T  D  Q         p.120

          .         .         .         .         .         .       g.53796
 CGGGAGATGGGGCCCCACAGGGCCTCCTGCGTCAATGCCATGGAAGGGAAGAAACTGGCC       c.420
 R  E  M  G  P  H  R  A  S  C  V  N  A  M  E  G  K  K  L  A         p.140

          .         .         .         .         .         .       g.53856
 CAGGATGTCAGAGCCAAGGGCTACCTGGAGTGCTCAGCCCTTAGCAATCGGGGAGTACAG       c.480
 Q  D  V  R  A  K  G  Y  L  E  C  S  A  L  S  N  R  G  V  Q         p.160

          .         .         .         .         .         .       g.53916
 CAGGTGTTTGAGTGCGCCGTCCGAACTGCCGTCAACCAGGCCAGGAGACGAAACAGAAGG       c.540
 Q  V  F  E  C  A  V  R  T  A  V  N  Q  A  R  R  R  N  R  R         p.180

          .         .         .                                     g.53952
 AGGCTCTTCTCCATCAATGAGTGCAAGATCTTCTAA                               c.576
 R  L  F  S  I  N  E  C  K  I  F  X                                 p.191

          .         .         .         .         .         .       g.54012
 accccaagagacttcacacaacacttatgtatgcaccccaaagactaatggggagaggga       c.*60

          .         .         .         .         .         .       g.54072
 gggccgggaagccaggaaagcttggtgttttctctgggtacaccccaagcagcgtctcct       c.*120

          .         .         .         .         .         .       g.54132
 tttggatacagttattgatgaggcttggccactggatgttttcactaactacactctaca       c.*180

          .         .         .         .         .         .       g.54192
 agtgaactccttgcccaggccagttagaaaatcccttggggaactgtgatgaatattcca       c.*240

          .         .         .         .         .         .       g.54252
 tctttgattaaaaaagtgaaatagtctccataattttggacgatgaagtgagtttttcaa       c.*300

          .         .         .         .         .         .       g.54312
 agaattccatatttaaagacacattttatttaactaataacaaaatgtattgcttttgta       c.*360

          .         .         .         .         .         .       g.54372
 tatatttagttttcacacttggaaaatcttttcctacatcctcgaaaacataaactcctc       c.*420

          .         .         .         .         .         .       g.54432
 tgtgagtgaaatgcttgtacgaagctctgccatatgtttgtagtgttattattttcacct       c.*480

          .         .         .         .         .         .       g.54492
 caagtagaaagtctgttgaaaccacttggctgctggatttaaatgggtaatcaaatttaa       c.*540

          .         .         .         .         .         .       g.54552
 aaatgaccataaatgaatctttgcaatttgttttctacttacctgttattcacagttgga       c.*600

          .         .         .         .         .         .       g.54612
 tataaaatacagttccataagatatcctaatactgcctaatgattttaaagttatcacta       c.*660

          .         .         .         .         .         .       g.54672
 tatttttctgaaatgataaaacatcattcatttatttactatattgtctttcactcaact       c.*720

          .         .         .         .         .         .       g.54732
 ccagttatgcactaaatattctcctctcattcaccaagattgattgaaacaccatctttc       c.*780

          .         .                                               g.54754
 aggtagagaatcagactgctcc                                             c.*802

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ras homolog family member H protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.