transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) (TAP2) - coding DNA reference sequence

(used for mutation description)

(last modified April 30, 2014)

This file was created to facilitate the description of sequence variants in the TAP2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering TAP2 transcript NM_000544.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .                                               g.24
 GGCCTGCTCGCACTGCACATCTAG                                           c.24
 G  L  L  A  L  H  I  X                                             p.7

          .         .         .         .         .         .       g.84
 ggcactagtagcctcatccaggatgaggacccgcgggtctcgtacaagggcccgggcaat       c.*60

          .         .         .         .         .    | 02    .    g.537
 ggccagacgttgtttctgtcccgcagccagctggcttcccttctcccctacat | ctgtgta    c.*120

          .         .         .         .         .         .       g.597
 tattccatgctccatttcctggatgaagtcatctgcgtgggcagcctgggcagccgccat       c.*180

          .         .         .         .         .         .       g.657
 caccttatcatcttcgcagctctgcagcccataagcaatgttgttcctcacagaaccgga       c.*240

          .         .         .    | 03    .         .         .    g.894
 gaacagcacaggctcctgcccaactgaaaccac | ctggctgtgcaggtagcagtgttcata    c.*300

          .         .         .         .         .         .       g.954
 ctgtgagatgggcttttcatccagcagcacctgtccccctgtgggctggtacagattctg       c.*360

          .         .         .         .         .         .       g.1014
 cagcagggcagccactgtgctcttcccagacccattgggtcccaccagcgccgtcacctc       c.*420

          .         .        | 04.         .         .         .    g.1251
 accaggacgtagggtaaacgtcagccc | cttgagcacaggcctgtcagggcgattgggata    c.*480

          .         .         .         .         .         .       g.1311
 tgcaaaggagacgtcttggaatttcacaaccccctgcagagtggtgggggcaagcgtgcc       c.*540

          .         .         .         .         .         .       g.1371
 aggtgaaggcagatttggctgtcggtccatgtaggagaaaaccttctctgcagctcccac       c.*600

          .         .         .       | 05 .         .         .    g.2957
 gttgctgagcatatccccatatatgtataccagggt | ctgcacatagctccccacgctctc    c.*660

          .         .         .         .         .         .       g.3017
 ctggtagatcataaaggaaagcaggctgccctgggtgagctccccatcctgcatctgctg       c.*720

          .         .         .         .      | 06  .         .    g.3242
 cagcccacagctcagcatcagcatctgcacccccaagtgcagcac | cctccttacgagcag    c.*780

          .         .         .         .         .         .       g.3302
 gtacaaggcgcgttccaggtctctccgccaatacagctgccgacattgttcaagggcctc       c.*840

          .         .         .         .         .         .       g.3362
 tttatagcgacagacttcatgctcctcggccccaaaactgcgaacggtctgcagccctcc       c.*900

          .         .         .         .         .         .       g.3422
 aacggcttcccgcaccacctgccccgccctggccactgcatcctggatctcccgaagcac       c.*960

     | 07    .         .         .         .         .         .    g.5811
 ttc | ctgatggcgggtgttgtacaccttctccgctgctattgtgaagggcatgtgcagcag    c.*1020

          .         .         .         .         .         .       g.5871
 agaaaggagggtgagtcgaggcgatatgctgagcatgaagccatacagccccaccacttt       c.*1080

          .         .         .         .         .         .       g.5931
 caccaggcttcgcaagagcacattggcatttaaaggaagccagttactcatcagggtggt       c.*1140

          .         .          | 08        .         .         .    g.6274
 atccgagctcagccgtgagttcagctccc | ctgtcttagtctcctggaagaaaccgaggtc    c.*1200

          .         .         .         .         .         .       g.6334
 ctggcgcagcagggaggagaaaagctgctcccggatccgcaagttgattcgagacatggt       c.*1260

          .         .         .         . | 09       .         .    g.8157
 gtaggtgaagcagcctcctcggcagcctgcagacagtgag | ctgccaaaggagaagaggca    c.*1320

          .         .         .         .         .         .       g.8217
 catgaagaagatggcactggcaaaggcatgggggtcaaaatcacctcccaggatgtcaat       c.*1380

          .         .         .      | 10  .         .         .    g.8366
 cacacgaccagaatagtgagggattaatgtctcac | ccaaaacagcaaggacaaggaagaa    c.*1440

          .         .         .         .         .         .       g.8426
 gaaggcggcaacgaggagaggcaggtccggcctggagagcttcagcagcctccacatcaa       c.*1500

          .         .         .         .         .         .       g.8486
 gactttgttgttcacctggtcctgctccttctcctgggctccaggagggctcagaacagc       c.*1560

          .         .         .         .         .         .       g.8546
 ccacagtgaccagctgagccccgcagccccgtaccccaccagcagccagctccaaggggc       c.*1620

          .         .         .         .         .         .       g.8606
 tgaagcgactctggctgggggagcacgtgaggcccccgcgaccagggctctcagggagac       c.*1680

          .         .         .         .         .         .       g.8666
 agtcaggggggtggccagacagagcgggagcagcagtgtccccacaaatcccagcagccc       c.*1740

          .         .         .         .         .         .       g.8726
 tcttagctttagcagcccccacagccctcccagccgcagggtcccctccagccatagtcc       c.*1800

          .         .         .         .         .         .       g.8786
 tggcagcccttgaggaagcaaagtccccagagggccctgaagcagccacagtaaagccgc       c.*1860

          .         .         .         .         .   | 11     .    g.9261
 gtccaccagcagcagggaggtccagggtctcaggtcagggagccgcatggct | cagccgcg    c.*1920

          .         .         .         .         .         .       g.9321
 gcggggagaccgcagctccggggacttctgcttcagcgctgaggtccgctccgtctctcc       c.*1980

          .         .         .         .         . | 12       .             g.9381
 caacctcgctaccggctctggtccgccagctacgctcggccagggcgggc | t             c.*2031

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.