activation-induced cytidine deaminase (AICDA) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the AICDA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering AICDA transcript NM_020661.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .                                     g.39
 CAAAAGGATGCGCCGAAGCTGTCTGGAGAGACGAACTGA                            c.39
 Q  K  D  A  P  K  L  S  G  E  T  N  X                              p.12

          .         .         .         .         .         .       g.99
 attttcatgcagcccttcccaggctttgaaagttctttcgtggttttctacaaaagtatt       c.*60

          .        | 02.         .         .         .         .    g.451
 ccagcagtaaaaataat | ctttgaaggtcatgatggctatttgcaccccggcgcggtgcag    c.*120

          .         .         .         .         .         .       g.511
 ccgccgcagcccctcgggctcagccttgcggtcctcacagaagtagaggcgcgcggtgaa       c.*180

          .         .         .         .         .         .       g.571
 gatcctcagactgaggttggggttccctcgcagaaagtcggccacatgtcgggcacagtc       c.*240

          .         .         .         .         .         .       g.631
 gtagcaggggctccaggaggtgaaccaggtgacgcggtagcagcggccagggtctaggtc       c.*300

          .         .         .         .         | 03         .    g.2070
 ccagtccgagatgtagcggaggaagagcaattccacgtggcagccgtt | cttattgcgaag    c.*360

          .         .         .         .         .         .       g.2130
 ataaccaaagtccagtgaaaaggatgtagcactgtcacgcctcttcactacgtagcacag       c.*420

          .         .         .         .         .         .       g.2190
 gtaggtctcacgccgacccttagcccagcggacatttttgaattggtaaagaaacttcct       c.*480

          .       | 04 .         .         .         .         .    g.7997
 ccggttcatcaagagg | ctgtccatagtggtgtccagagtgtcttcttgcctccctgcaag    c.*540

          .         .         .         .    | 05    .         .                    g.8057
 tctcaggccagaaaaatctcacttcaattaatgatggttctct | a                    c.*584

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Activation-induced cytidine deaminase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.