Bruton agammaglobulinemia tyrosine kinase (BTK) - coding DNA reference sequence

(used for mutation description)

(last modified April 25, 2014)

This file was created to facilitate the description of sequence variants in the BTK gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering BTK transcript NM_000061.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .                           g.42
 CTCATGCCAGCAACTGTACATGATGGTATATACCTTCTCTGA                         c.42
 L  M  P  A  T  V  H  D  G  I  Y  L  L  X                           p.13

          .         .         .         .         .         .       g.102
 agccagatgaggcctgtagagacgtaggccttgggcaatgtgttcagcagtctcactgtt       c.*60

          .         .         .         .         .       | 02 .    g.680
 agtaaatctctcatatggcatcttccccagggagtaaatttcccacatcaaaaccc | caaa    c.*120

          .         .         .         .         .         .       g.740
 agcccaaatgtcagatttgctgctgaacttgctatacatcaggacttccggtggggacca       c.*180

          .         .         .         .         .      | 03  .    g.1441
 ccggactggaaatttggagcctactgagcttgtgtattcatcatccaggacatac | ctgga    c.*240

          .         .         .         .         .         .       g.1501
 caggccgaaatcagatactttaacaactccttgatcgtttaccaaacagtttcgagctgc       c.*300

  | 04       .         .         .         .         .         .    g.2918
  | caggtctcggtgaaggaactgctttgactccaggtattccatggcttcacagacatcctt    c.*360

          .         .         .         .         .         .       g.2978
 gcacatctctagcagctgctgagtctggaagcggtggcgcatctccctcaggtagttcag       c.*420

          .         .         .         .         .         .       g.3038
 gaggcagccattggccatgtactcagtgatgatgaagatggggcgctgcttggtgcagac       c.*480

          .         .         .        | 05.         .         .    g.3613
 gccatacaactgcaccagcttctcatgggaaagattc | atcatgactttggcttcttcaat    c.*540

          .         .         .         .         .         .       g.3673
 gaattcatcttcagacatggagccttctttgatcatcttgatggccacgtcgtactggcc       c.*600

          .         .         .         .         .         .       g.3733
 tctccatttcccatacttcactaccccaaattgtccagtccccagctccttcaagaaggt       c.*660

          .         .          | 06        .         .         .    g.4346
 caggtcctttggatcaatttcccatgatc | cgtatcccaggcctgcagtggaaggtgcatt    c.*720

          .         .         .         .     | 07   .         .    g.5132
 cttgttttgttgagacactggatatttgagcctggatatgagtc | ctgcagagttgtgctg    c.*780

          .         .         .         .         .         .       g.5192
 atggtagttaatgagctcagggatggtgctgaaaaggtgcttctcagccaggtaatactg       c.*840

          .         .         .         .         .   | 08     .    g.5431
 gctctgaggtgtggaacacacaacataatgacgtatcaccccttgagggtcc | cctgtgga    c.*900

          .         .         .         .         .         .       g.5491
 tttagcaaacacagacactgtatatttgccagctttgctggagtctctgacaatgaaacc       c.*960

          .   | 09     .         .         .         .         .    g.6147
 tccttctttccc | ctcttgctttagcagttgctcagcctgactccgagtcatgtgtttgga    c.*1020

         | 10.         .         .         .         .         .    g.6947
 ataccac | tcatacatttctatggagtcttctgcttcagtgacatagttactaggaatgta    c.*1080

          . | 11       .         .         .         .         .    g.7424
 gccttcctgc | ccatttttatctcgtgctctccaccatggtaagttgctttcctccaagat    c.*1140

          .         .         .         .         .         .       g.7484
 aaaatattcatcacccttccgcagctgtagatcatttgcattcattggcatgtaatcata       c.*1200

          .         .         .         .         .         .       g.7544
 aagggccacaacctttttcagctcacttgtggagactggtgctgctgctggctcaggcgg       c.*1260

          .         | 12         .         .         .         .    g.9021
 tagtggctttttcaagat | ctggtcctcctcaggcgttgggggaagaggcttttttgtctt    c.*1320

          .         .       | 13 .         .         .         .    g.9401
 ccggtgagaactcccaggttttaagc | ttccattcctgttctccaaaatttggcagcccat    c.*1380

          .         .         .         .         .         .       g.9461
 agcatttttggctgtctgagagcagcagagatactgcccatcgatccagaagcaagggtg       c.*1440

          .         .         .      | 14  .         .         .    g.16829
 atatttctgaaccagatcactgttgtaccggatta | cgtttttgagctggtgaatccaccg    c.*1500

          .         .         .         .         .        | 15.    g.18442
 cttccttagttcttcagttggggagaagacgtagagaggcccttcatcatatacaac | ctg    c.*1560

          .         .         .         .         .         .       g.18502
 gaagggataagggaacctttcaatgattgaaatttgctccatttcactggactcttcacc       c.*1620

        | 16 .         .         .         .         .         .    g.21396
 tcttct | cggaatctgtctttctggaggaggatttttttcaggaaccactgtttcaacaca    c.*1680

          .         .         .         .      | 17  .         .    g.21965
 agtgatcttctcaacatctattgaacccttcttactgcctcttct | cccacgttcaaagtc    c.*1740

          .         .         .         .         .         .       g.22025
 atactcatagtaggagagtttgtgcacggtcaagagaaacaggcgcttcttgaagtttag       c.*1800

          .         .         .         .         .         .       g.22085
 aggtgatgttttctttttctgttgggatcgcttcagaaagatgctctccagaatcactgc       c.*1860

          .         .         .       | 18 .         .         .    g.32892
 ggccatagcttcttctttctggagttcacctgtgtg | ctcagtcctgacttaatgcaggta    c.*1920

          .         .         .         .         .         .       g.32952
 gcttcccagatgcattgagatgccaggacttggaaggtgggactcgatcgcagcagacac       c.*1980

          .         .         .         .         .         .       g.33012
 tggccctggagacatattcttacagtccagagaggaaggacagtctgagcaaaccccacc       c.*2040

          .          | 19        .         .         .         .                                            g.33072
 ctttcacagccactcagtt | c                                            c.*2060

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Bruton agammaglobulinemia tyrosine kinase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.