Fanconi anemia, complementation group L (FANCL) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the FANCL gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering FANCL transcript NM_018062.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .                 g.57
 CTTACTACAATATGGACATTCACCAAATATGATGTTAAAACTCTGTCTACTAGTTAG          c.57
 L  T  T  I  W  T  F  T  K  Y  D  V  K  T  L  S  T  S  X            p.18

          .      | 02  .         .         .         .         .    g.1459
 tagtcctctcagcca | ctcatataagcatatttgatggaaaggttgtccacactgagaatt    c.*60

          .         .         .         .         .         .       g.1519
 atcacacacttgatcaggaatggtaccgtcaagttgataagcataacaaattccacaatc       c.*120

          .   | 03     .         .         .         .         .    g.2806
 catagtaaaatc | agatttttccaggatagcacgagctggaaaatcaatttctaaaacatc    c.*180

          .         .         .     | 04   .         .         .    g.2947
 tttcaaattttgtaacacactattttctggatcc | cacaaatgtatgttcctgctcagctt    c.*240

          .         . | 05       .         .         .         .    g.3366
 aattcccaggggttttacca | catggtcagctccaagaaagaagcactcaggaagcatagt    c.*300

          .         .         .         .     | 06   .         .    g.5632
 aggatgcctggggtctacctctatatttatggaaacattattac | ctaatgcaattctgcg    c.*360

          .         .         .         .         .         .       g.5692
 tgctgttgcactccgtggaggtttttctggctcaagtacccaggtcttctcatcgatttc       c.*420

          .         .         .         .         .         .       g.5752
 atccataacatcccagaatgcctttagtgattctattgctgccaaaaactgactataaat       c.*480

          .      | 07  .         .         .         .         .    g.38531
 gcttattaaggagct | ctgaggtgtccaggaggcacaaaatggaacaggaaaatccacaaa    c.*540

          .         .     | 08   .         .         .         .    g.44058
 ataatctggtgattctgcaggata | ctttgccttcaacttgagagtgattaaatgctctct    c.*600

          .         .         .         .         .         .       g.44118
 accagaagcatcttctgcttttaacttgatggtactgaagcaggtatccgcatacacaag       c.*660

   | 09      .         .         .         .         .         .    g.61893
 t | ttatcccaaccaagagttcctatctcttcaataaggcttgagtagaactggggaggagg    c.*720

          .         .         .         .   | 10     .         .    g.66638
 aggtagtgcatacagctcttgtctattctttaaggcaacttc | caaaagcatcttcaactc    c.*780

          .         .         .          | 11        .         .    g.69727
 catcataaagctcattagatcaggagagtgctgcattct | ctgttgtactattcgatggta    c.*840

          .         .         .         . | 12       .         .    g.71966
 tccactaagtattgttctcagctgccaactacataataat | cttgcattcttcagttgtaa    c.*900

          .         .         .          | 13        .         .    g.81131
 atcttcaggcaacactatcctaaggtggaagtctcttcc | ctgagccgagatgaatccctc    c.*960

          .         .         .         .         .         .       g.81191
 atacacggttttcgaccggttctggggcagaagcagggggcactggcgcaacaggctcgc       c.*1020

          .         .         .         .         .         .       g.81251
 ttccgtcaccgccatggctcgaagtccggagaaacacagaaaagctctagacctgctggg       c.*1080

          .         .   | 14     .         .         .         .                                         g.81311
 tcctgcacatgcgcagtccgct | c                                         c.*1103

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Fanconi anemia, complementation group L protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.