growth factor independent 1 transcription repressor (GFI1) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the GFI1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering GFI1 transcript NM_005263.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .                                                         g.12
 CAGTGTGGATGA                                                       c.12
 Q  C  G  X                                                         p.3

          .         .         .         .         .         .       g.72
 aagtgtgtttcttcatgtctgacttctggtggaacctcttgccacagtactgacaggggt       c.*60

          .         .         .         .         .         .       g.132
 agggccgagtgtctgagtggataagcaggtgtgtggacagtgtggatgacctcttgaagc       c.*120

          .         .         .     | 02   .         .         .    g.1786
 tcttcccacagatcttacagtcaaagctccgttc | ctgcgagtgcacggctttgtgctgct    c.*180

          .         .         .         .         .         .       g.1846
 ccaggctcaccgcgtgcccgaaggtcttgccgcacatctcgcaggcaaagggtctggtac       c.*240

          .         .         .         .         .   | 03     .    g.2021
 cgctgtgggacctgcgcacgtgcacctcgagcccgtgcggcgtggagaacac | cttgctgc    c.*300

          .         .         .         .         .         .       g.2081
 acttgatgcacttgtaggagccgccgcccagcagcaggcgggtgcacagcagctccgact       c.*360

          .         .         .         .         .         .       g.2141
 ccaccttgacgccagcgcccttgtctgcgtgcagcccgtggccacgctcggggtacagca       c.*420

          .         .         .         .         .         .       g.2201
 agcccgccgctgccgtgggcctctcatacagcccggctgccgcagacccgaagtcgccgt       c.*480

          .         .         .         .         .         .       g.2261
 agagccctaggccagggccagcggtggcaccggcccctgcgctgcagctccctggcgccc       c.*540

          .         .         .         .         .         .       g.2321
 cggcccccgcgccgccggcagcccgcttcgggccgtacagcgcggccgggtggccaggct       c.*600

          .         .         .         .         .         .       g.2381
 ccggggcgggttcgcagaagaggcccaggccagcgccacgctccagggccccacacggtc       c.*660

          .         .         .         .         .         .       g.2441
 ggtagctctgcaccaggtgccgcaggtcagaacccgccaggccgctccatgagtacggtt       c.*720

          .         .         .         .         .         .       g.2501
 tgaaaggcagggggaagggctgggcttcgtccagcgatgggcacattgacttctccgagg       c.*780

  | 04       .         .         .         .         .         .    g.4336
  | ctggagacgcggagggtgacgggggcctccagaagtcctcaaactccgagctccgttcgc    c.*840

          .         .         .         .         .         .       g.4396
 agacgctgccttcgcagctgtctggggatgcggaggctctgtctggggcttcggtcagct       c.*900

          .         .         .         .         .         .       g.4456
 gcgattcgggggacaaacggtcccggggctccgccttcgccccgcctgcatttgaagtgc       c.*960

     | 05    .         .         .         .         .         .    g.4842
 tgt | ctgctcggctaggcgccggtacattctctaaacggagggaatagtctggtcctgggg    c.*1020

          .         .         .         .         .         .       g.4902
 agcgcggctggtggtagctgtgagccttcttgcttttgacgagaaatgagcgcggcatgg       c.*1080

          .         .         .         .         .         .       g.4962
 tggtccggcactttccccactgcgccccaagagtccctggagccgctgtcacccacggtc       c.*1140

          .         .         .        | 06.         .         .    g.8161
 actccgagggcttgctcagccccagcccggaggagac | cttgacacccaatccgagaggtt    c.*1200

          .         .         .         .         .         .       g.8221
 tgctcatttcccttcggatttaggtaatggttaaatttggaagaggtgggcgagcgccga       c.*1260

          .         .         .         .         .         .       g.8281
 gcccccggcggagagggccctggcggcgcgtcccgcgggcgcccggcgggaccggtgggc       c.*1320

          | 07         .         .         .         .         .                                                       g.8341
 gcaccctc | a                                                       c.*1329

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Growth factor independent 1 transcription repressor protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.