late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (LAMTOR2) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the LAMTOR2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering LAMTOR2 transcript NM_014017.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.1044
                 ggtggggcggggttgagtcggaaccacaatagccaggcgaagaa       c.-121

 .         .         .         .         .         .                g.1104
 actacaactcccagggcgtcccggagcaggccaacgggactacgggaagcagcgggcagc       c.-61

 .         .         .         .         .         .                g.1164
 ggcccgcgggaggcacctcggagatctgggtgcaaaagcccagggttaggaaccgtaggc       c.-1

          .         .         .         .         .         .       g.1224
 ATGCTGCGCCCCAAGGCTTTGACCCAGGTGCTAAGCCAAGCCAACACTGGAGGCGTCCAG       c.60
 M  L  R  P  K  A  L  T  Q  V  L  S  Q  A  N  T  G  G  V  Q         p.20

          | 02         .         .         .         .         .    g.1589
 AGCACCCT | GCTGCTGAATAACGAGGGATCACTGCTGGCCTACTCTGGTTACGGGGACACT    c.120
 S  T  L  |  L  L  N  N  E  G  S  L  L  A  Y  S  G  Y  G  D  T      p.40

          .         .         .         .         .         .       g.1649
 GACGCCCGGGTCACCGCTGCCATAGCCAGTAACATCTGGGCCGCCTACGACCGGAACGGG       c.180
 D  A  R  V  T  A  A  I  A  S  N  I  W  A  A  Y  D  R  N  G         p.60

          .         .         .         .         .  | 03      .    g.4261
 AACCAAGCGTTTAATGAAGACAATCTCAAATTCATCCTCATGGACTGCATG | GAGGGCCGT    c.240
 N  Q  A  F  N  E  D  N  L  K  F  I  L  M  D  C  M   | E  G  R      p.80

          .         .         .         .         .         .       g.4321
 GTAGCCATCACCCGAGTGGCCAACCTTCTGCTGTGTATGTATGCCAAGGAGACCGTGGGC       c.300
 V  A  I  T  R  V  A  N  L  L  L  C  M  Y  A  K  E  T  V  G         p.100

          .         .  | 04      .         .         .         .    g.4628
 TTTGGAATGCTCAAGGCCAAG | GCCCAGGCTTTGGTGCAGTACCTGGAGGAGCCCCTCACC    c.360
 F  G  M  L  K  A  K   | A  Q  A  L  V  Q  Y  L  E  E  P  L  T      p.120

          .                                                         g.4646
 CAAGTGGCGGCATCTTAA                                                 c.378
 Q  V  A  A  S  X                                                   p.125

          .         .         .         .         .         .       g.4706
 cggcattggtggaagctggggtcagaaaagagaaatgaccatttggaggggcggggcctc       c.*60

          .         .         .         .         .         .       g.4766
 ctagaagaaccttcttagacaatggggggaggatgggactttgttttttccaagaataaa       c.*120

          .                                                         g.4785
 cttcaactcctgtcatgtg                                                c.*139

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.