ribosomal protein L26 (RPL26) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the RPL26 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000017.10, covering RPL26 transcript NM_000987.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTTGCTGGGGTGAATGCCTACGTGGACAGTTGTGCCATTAGCCTTTTCCCGCTGCACCCG       c.60
 L  A  G  V  N  A  Y  V  D  S  C  A  I  S  L  F  P  L  H  P         p.20

          .         .         .         .         .         .       g.120
 TTCAATGTAGATAACATATTTCTTCCTGTAAACCTGGACTACTTTGCCAATTTGCTGACC       c.120
 F  N  V  D  N  I  F  L  P  V  N  L  D  Y  F  A  N  L  L  T         p.40

          .         .  | 02      .         .         .         .    g.2386
 TTTATAGTGTCCACGTACAAC | CTGAACTTCATCATCCTTTCGGATGGGCATGGATCGCAC    c.180
 F  I  V  S  T  Y  N   | L  N  F  I  I  L  S  D  G  H  G  S  H      p.60

          .         .         .         .         .         .       g.2446
 GTTGTACTTCTGTCTCAGCTCTTTGGAAAGAGGGGAAGACATAATCTTCCTTCGAATGTG       c.240
 V  V  L  L  S  Q  L  F  G  K  R  G  R  H  N  L  P  S  N  V         p.80

          .         .         .         .         .         .       g.2506
 GGAAGGTGCATTGAAATGCCTTTTGCGATTCTTGCTTCGGTCGGAAGTCACAAAGGGATT       c.300
 G  R  C  I  E  M  P  F  A  I  L  A  S  V  G  S  H  K  G  I         p.100

          .     | 03   .         .         .         .         .    g.3407
 AAACTTCATTTTGG | CCGCTCCCGCTTCGGTGATGGCCGCAAAAGGGAAGAGAACTACACG    c.360
 K  L  H  F  G  |  R  S  R  F  G  D  G  R  K  R  E  E  N  Y  T      p.120

          .                                                     g.3425
 CTGCTTCCGGTTCTGTAA |                                              c.379
 L  L  P  V  L  X                                                p.125

          .         .        | 04.         .         .         .                                    g.3485
 gtttaccaaagatctcgcgagacctat | c                                    c.*28

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Ribosomal protein L26 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.