B-cell linker (BLNK) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the BLNK gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000010.10, covering BLNK transcript NM_013314.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CTCTTCACCATTTTTCTTTCTGCCCAAGGCATATTGTTTTGTTGCTTCAATAAATCGCAC       c.60
 L  F  T  I  F  L  S  A  Q  G  I  L  F  C  C  F  N  K  S  H         p.20

          .         .         .                                     g.99
 AGGAATATTATATACTCGCTTATTAAAGAATACAACTAG                            c.99
 R  N  I  I  Y  S  L  I  K  E  Y  N  X                              p.32

          .         .         .         .         .        | 02.    g.3170
 tgtatatggttgtttggaatcatggccagagcttttccgaataagaaatgatccatc | ctt    c.*60

          .         .         .         .         .         .       g.3230
 gtttgatctgtgcaatgcctcttcagcagactttcgatcacaggctccagcataccatgg       c.*120

          .         .  | 03      .         .         .         .    g.4113
 cttgcagagaacgccagcttc | ctgttctgaaatagtggaattagatgaaaagctgggtag    c.*180

          .         .         .         | 04         .         .    g.7171
 gggcccatccacagttgggtttcccccttctgtaaatc | ttggcagaggtatgggtttttg    c.*240

          . | 05       .         .         .         .         .    g.7674
 gtggatttgt | ttctgggcaggaggaaacactggtgactgcacagcttcttgtctgtgact    c.*300

          .         .         .      | 06  .         .         .    g.10128
 tgaccctcggtggcgttcagcaggtataggttttt | cttcacaaacacttgaagcattctg    c.*360

          .         | 07         .         .       | 08 .         . g.12944
 ttgagaggcaactggagt | tgtcttcagtggtgtcgttggttttttc | ccggcccgtggcaa c.*420

          .         .         .         .         .       | 09 .    g.18417
 cggggatggtgcagctggtggaggtgacttggtttcccaggccccactgtttcgac | ctga    c.*480

          .         .         .         .         .         .       g.18477
 agctgttcctggaggagaggcgggcgttgaggaatttggcttggttgatctattcaccat       c.*540

       | 10  .         .         .         .         .         .    g.19800
 gggag | ctttttcaggtggaggtgaactgctttctgtgggatgaatatagttttcatcatt    c.*600

          .         .        | 11.         .         .         .    g.26951
 atcttccacggggaccacataatcagc | ctcatcctcaaggaggcctttgggtttgggtgg    c.*660

          .         .         .         .         .         .       g.27011
 gacttgaggtttctgcaaagcagtcagggccggcagggtggaggtgagccttgctttctc       c.*720

          .         .         .         .         .         .       g.27071
 tgaaggccagctgggcttactgggaagtgtcttgctgaagggtggggaatgcctctggct       c.*780

          .  | 12      .         .         .         .         .    g.30551
 tgatcgattgt | ctatatactcgcctctggcgaagggcagggctgggtgaaccggcctggt    c.*840

          .         .         .         .         .         .       g.30611
 ttcctgctctactggaggcggctcgtagctgtcatcagcgttctcctcggcgggcatcac       c.*900

          .         .         .         .         | 13         .    g.33898
 gtacatctctgagtccgagtgctcatctggattttcatagtcgctgtc | aaagtcatcgga    c.*960

          .         .          | 14        .         .         .    g.45858
 ccactgctcctcttcgtcagcagggctct | ctgaagcgtagtcccttcgaggaacacttgg    c.*1020

          .          | 15        .         .         .         .    g.50117
 aggtgctttgacttttagc | tttttgattttattcattattccaccttcattgtttttaat    c.*1080

          .         .      | 16  .         .         .         .    g.74480
 atcatggaccatcttttgaagctgc | ctcaacttctgactggcggggacggttattttatt    c.*1140

          .         .         .         .         .         .       g.74540
 aagcttgtccattctgtttggtaattgtaagagacacgaataactgtccagtggtcacgt       c.*1200

          .         .         .         .         .         .       g.74600
 cagcagttcctggccctcctagggagcagcatggtaagcctctggtctcaagggttccgg       c.*1260

          .         .         .         .         .         .       g.74660
 ccactcaagtctgatttctgagagtgcaggctgctggcaaacacccctgctctagggaga       c.*1320

          . | 17       .         .         .         .         .                                                     g.74720
 agtaaaactt | a                                                     c.*1331

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The B-cell linker protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.