signal transducer and activator of transcription 1, 91kDa (STAT1) - coding DNA reference sequence

(used for mutation description)

(last modified May 1, 2014)

This file was created to facilitate the description of sequence variants in the STAT1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000002.11, covering STAT1 transcript NM_007315.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
          .         .         .         .         .         .       g.60
 CATACTGTCGAATTCTACAGAGCCCACTATCCGAGACACCTCGTCAAACTCCTCAGGAGA       c.60
 H  T  V  E  F  Y  R  A  H  Y  P  R  H  L  V  K  L  L  R  R         p.20

          .         .         .         .    | 02    .         .    g.999
 CATGGGGAGCAGGTTGTCTGTGGTCTGAAGTCTAGAAGGGTGA | ACTTCAGACACAGAAAT    c.120
 H  G  E  Q  V  V  C  G  L  K  S  R  R  V  N |   F  R  H  R  N      p.40

          .         .         .         .         .          | 03    g.2011
 CAACTCAGTCTTGATATATCCAGTTCCTTTAGGGCCATCAAGTTCCATTGGCTCTGGTG | C    c.180
 Q  L  S  L  D  I  S  S  S  F  R  A  I  K  F  H  W  L  W  C  |      p.60

          .         .         .         .         .         .       g.2071
 TTCCTTTGGCCTGGAGTAATACTTTCCAAAGGCATGGTCTTTGTCAATATTTGGATACAG       c.240
 F  L  W  P  G  V  I  L  S  K  G  M  V  F  V  N  I  W  I  Q         p.80

          .         .         .         .         .         .       g.2131
 ATACTTCAGGGGATTCTCAGGAATATTCTCAGCAGCCATGACTTTGTAATTGCGAATGAT       c.300
 I  L  Q  G  I  L  R  N  I  L  S  S  H  D  F  V  I  A  N  D         p.100

          .         .         .         .         .         .       g.2191
 GTCAGGGAAAGTAACAGCAGAAAGTTCTTTCTTCGTGTAGGGTTCAACCGCATGGAAGTC       c.360
 V  R  E  S  N  S  R  K  F  F  L  R  V  G  F  N  R  M  E  V         p.120

       | 04  .         .         .         .         .         .    g.4081
 AGGTT | CGCCTCCGTTCTGGGACCGCTCCACCCATGTGAATGTGATGGCCCCTTCCCGGGA    c.420
 R  F  |  A  S  V  L  G  P  L  H  P  C  E  C  D  G  P  F  P  G      p.140

          .         .         .         .         .         .       g.4141
 GCTCTCACTGAACCGCAGCAGGAAGGTCCCCGGCTGCTGGTCCTTCAACAGGGCACGCTC       c.480
 A  L  T  E  P  Q  Q  E  G  P  R  L  L  V  L  Q  Q  G  T  L         p.160

          .         .         .  | 05      .         .         .    g.4971
 TCGCTCCTTGCTGATGAAGCCCATGATGCAC | CCATCATTCCAGAGAGGGAGCAGGTGTTT    c.540
 S  L  L  A  D  E  A  H  D  A  P |   I  I  P  E  R  E  Q  V  F      p.180

          .                                                         g.4986
 TTTAATGAGTTCTAG                                                    c.555
 F  N  E  F  X                                                      p.184

          .         .         .         .         .  | 06      .    g.5799
 gatgctttcaatccaaagccagaagggaaaatttttatcatttatattttc | cttacaaaa    c.*60

          .         .         .         .  | 07      .         .    g.7572
 cctcgtccacggaatgagaccatcggggctggcgttaggac | caagaagcttctctcccaa    c.*120

          .         .         .         .         .         .       g.7632
 catgttcagctggtccacattgagacctcttttggtgacagaagaaaactgccaactcag       c.*180

          .         .         .         .         .        | 08.    g.8815
 cacttctgaaagctgagcccatcgtgcacatggtggagtcaggaagaaggacagatt | cct    c.*240

          .         .         .         .         .         .       g.8875
 gggttccgccaccagcatgttgtaccaaaggatggaggcccaaccgctcgggagctggct       c.*300

          .         .         .       | 09 .         .         .    g.9504
 gacgttggagatcaccacaacgggcagagaggtcgt | ctcgaggtcaattaccaaaccagg    c.*360

          .         .         .         .         .         .       g.9564
 ctggcacaattgggtttcaaaactaagggagtgaagctcttcagtaacgatgagaggacc       c.*420

  | 10       .         .         .         .   | 11     .         . g.12042
  | ctcattcgttctggtgccagcatttttctgttctttcaattg | caggtgccgaaattcagc c.*480

          .         .         .         .         .         .       g.12102
 cgccagactgccattggtggactcctccatgttcatcacttttgtgtgcgtgcccaaaat       c.*540

          .       | 12 .         .         .       | 13 .         . g.14799
 gttgaacttcctaaat | ccttttactgtatttctctcattcacatct | ttatcaaataagac c.*600

          .         .         .         .       | 14 .         .    g.16412
 tttgactttcaaattataattcagctcttgcaatttcaccaacagt | ctcaacttcacagt    c.*660

          .         .         .         .         .         .       g.16472
 gaactggacccctgtcttcaagaccagcggcctctgagggtgcgttggcatgcagggctg       c.*720

          .          | 15        .         .         .         .    g.20272
 tctttccaccacaaacgag | ctctgaatgagctgctggaaaagactgaaggtgcggtccca    c.*780

          .         .         .         .         .         .       g.20332
 taacacttgtttgttttttgtgatagggtcatgttcgtaggtgtatttctgttccaattc       c.*840

          .         .         .         .         .         | 16    g.23028
 ctccaactttttaagctgctgccgaacttgctgcagactctccgcaactatagtgaac | ca    c.*900

          .         .         .         .         .         .       g.23088
 gttctgcagctgatccaagcaagcattgggcggccccccaatacaggcgctctgctgtct       c.*960

          .         .         .         .         .         .       g.23148
 ccgcttccactccactagttcatcattaatcagggcattctgggtaagttcagtgacatt       c.*1020

          .         .         . | 17       .         .         .    g.23417
 cagcaactctattattttgtgaactacttc | ctttctcttattgtcaagcattaaatacat    c.*1080

          .         .         .         .         .         .       g.23477
 cttcttgagtaacagctgttcttgtttctgatcactctttgccacaccattggtctcgtg       c.*1140

    | 18     .         .         .         .         .         .    g.24854
 tt | ctctgttctgcaaggttttgcatttgaagtcatattcatcttgtaaatcttccaggct    c.*1200

          .         .  | 19      .         .         .         .    g.26283
 cttgatttcatgctctataca | cataaccttgtccttcacatttctgactttactgtcaag    c.*1260

          .         .         .         .         .  | 20      .    g.32742
 ctctttctgtttgtctaacatcactgtgctctgaatattccccgactgagc | ctgattaaa    c.*1320

          .         .         .         .         .         .       g.32802
 tctctgggcgttttccagaattttcctttcttccttcagacagctgtaaatgatcataga       c.*1380

          .         .         . | 21       .         .         .    g.34163
 catctggattgggtcttcctgaaaattatc | ctgaagattacgcttgcttttccttatgtt    c.*1440

          .         .         .         .         .         .       g.34223
 atgctgtagcaagaagttattctccaaagaaaagcgactatattgatcatccagctgtga       c.*1500

          .         .         .         .         .      | 22  .    g.35051
 caggaggtcatgaaaacggatggtggcaaatgaaacatcattggcagcgtgctcc | cagtc    c.*1560

          .         .         .         .         .         .       g.35111
 ttgcttttctaaccactgtgccaggtactgtctgatttccatgggaaaactgtcatcata       c.*1620

          .         .         .         .         .         .       g.35171
 aagctggtgaacctgctccaggaattttgagtcaagctgctgaagttcgtaccactgaga       c.*1680

      | 23   .         .         .         .         .         .    g.38751
 catc | ctgccaccttgtgccccaacaagggcctggggattcaaccaaaggagcagctacgc    c.*1740

          .         .         .         .         .         .       g.38811
 acagcacgttaggtgccaagactgtcgaggttatatacacagagtgcgaacgttaaccta       c.*1800

          .         .         .         | 24         .         .    g.39210
 gacagctctcgaggatggcatacagcaaatgaaacttt | tctgcgcgcaggatccggaagg    c.*1860

          .         .         .         .         .         .       g.39270
 gctaggcgggggcgcggcggtgcagcctctcccgagcgcgctgggtcgcctctgctcggt       c.*1920

          .         .         .         .         .         .       g.39330
 ctggggtctgccaggcgcgatccccccggtgcagccgagcccctccgcagactctgcgca       c.*1980

          .         .         .         .         .         .       g.39390
 ggaaagcgaaactacccggcaggagaaaaggcagcgctggcgcccggcccccttccgccc       c.*2040

          .         .         .  | 25      .         .         .                                g.39450
 ccaccaatcaccgggcggctccgcgctcagc | c                                c.*2072

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Signal transducer and activator of transcription 1, 91kDa protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.